Molecular Biology Reagents and Kits

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix, High ROX

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 500RXN Luminaris Color HiGreen High ROX qPCRMastermix

Thermo Scientific™ 96-Well Semi-Skirted Plates, Flat Deck

96-well semi-skirted PCR plates with a flat deck for improved sealing in PCR and qPCR applications. X25 THERMO-FAST 96 PCR DET PLATE 25 plates

Invitrogen™ SYBR GreenER™ qPCR SuperMix Universal

Incorporate the latest high-performance technology to provide the most reliable gene expression data on a variety of platforms including ABI 7500, Corbett Rotor-Gene™ etc. SYBR GREENER QPCR UNIVERSAL

Thermo Scientific™ 0.2 mL Strip Tubes

Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X120 STRIP 8X0,2ML DOMED REDpacks of 12

Fisherbrand™ Anodized Aluminum Blocks

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial settings. Fisherbrand™ Anodized Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.

Thermo Scientific™ Armadillo™ 384-Well PCR Plates

Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CLR WELLS GRN

Fisherbrand™ 96-Well Low-Profile, Skirted PCR Plates

Fit most thermal cyclers X25 Fisherbrand PCR plate 96-wells, full skirt, PP, natural - FB-0800

Applied Biosystems™ MicroAmp™ Cap Installing Tool

MicroAmp™ Cap Installing Tool MicroAmp® Cap Installing Tool (Handle)

Eppendorf™ 0.5 Model ThermoMixer™

ThermoMixer F0.5 w/thermoblock 24x0,5ml, GB plug

Thermo Scientific™ Armadillo™ 96-Well PCR Plate

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PCR hardshell plate Thermo Scientific 96 well25 plates

Thermo Scientific™ Thermo-Fast™ 96-Well Full-Skirted Plates

96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMOFAST SK96X0,2ML MARKEDlettering, 25 plates

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen qPCR MM (2x)

Applied Biosystems™ High Resolution Melt Software v3.0.1

High Resolution Melt Software v3.0.1 High Resolution Melt Software v3.0.1

Applied Biosystems™ SYBR™ Select Master Mix

Cost-effective solution for real-time PCR applications. 50ML SYBR® Select Master Mix, Bulk PackSYBR MASTER MIX

Applied Biosystems™ Custom 5' Fluorescent Labeled/Unlabeled Di-repeats

Custom 5' Fluorescent Labeled/Unlabeled Pairs 80000PMOL Custom 5' Fluorescent Labeled/UnlabeledPairs

Fisherbrand™ 0.2mL PCR Tube Strips

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR 8-tubes 0.2ml strip w/domed cap, PP,natural, FB-0266

Applied Biosystems™ Region of Interest (ROI) and Background Plates, 384-well

Region-of-Interest (ROI) and Background Plates are used to maintain the ViiA™ 7, QuantStudio™ 5, QuantStudio™ 6, QuantStudio™ 7 & QuantStudio™ 12K Flex real-time PCR systems. X2 Region of Interest (ROI) Background Plates,384-well

Applied Biosystems™ SYBR™ Green PCR Master Mix

Everything needed for SYBR™ Green dye–based PCR amplification and detection in a convenient, single-tube format. 5AMP 1000 RXN SYBR, GREEN PCR MASTER MIX, 5 PACK (

Thermo Scientific Pierce™ D-Luciferin

Get convenience and high performance at a low cost in firefly luciferase reporter assays with our D-Luciferin, formulated at greater than 99% purity as both monosodium and monopotassium salts. 1GR D-LUCIFERIN, MONOPOTASSIUM SALT

Applied Biosystems™ MicroAmp™ Optical Tube without Cap, 0.2mL

Designed to maximize sample recovery 200 UL MICROAMP OPTICAL TUBE WITHOUT CAP 0.2MLStore at room temperature

Invitrogen™ Nuclease-Free Water (not DEPC-Treated)

NUCLEASE-FREE WATER 5 X 100 MLAmbion® Nuclease-free water has not been treated

Thermo Scientific™ 96-Well Non-Skirted Plates

96-well non-skirted plates for use in PCR and qPCR applications. Available with black lettering for improved sample tracking during pipetting. X25 THERMOFAST 96X0,2ML BLACK(VE=25Stck.)

Water, Molecular Biology Grade, Fisher BioReagents

Chemical Name or Material: Water Name Note: 0.03μm filtered to ensure high purity CAS: 7732-18-5 Purity Grade: Molecular Biology Grade Purity Grade Notes: DNase-, RNase- and Protease-Free Physical Form: Liquid Molecular Formula: H2O Formula Weight: 18.02 20LT Water, Molecular Biology Grade (Sterile-Filtered)

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Invitrogen™ DEPC-Treated Water

100 ML DEPC-TREATED WATER (1 X 100ML) 100ML STOREat room temperature

Thermo Scientific™ Maxima SYBR Green/Fluorescein qPCR Master Mix (2X)

Ready-to-use solution optimized for qPCR and 2-step RT-qPCR. X10 qPCR, Maxima(R) SYBR green/Fluorescein qPCR

Thermo Scientific™ Maxima™ Probe 2X qPCR Master Mix with ROX Solution

Optimize qPCR with probe chemistry using standard cycling protocols with these ready-to-use qPCR master mixes. X10 qPCR, Maxima(R) probe qPCR master mix, ROX

Thermo Scientific™ 96-Well Non-Skirted Plates, Low Profile

Low profile 96-well plates for use in PCR and qPCR applications. X25 THERMOFAST LP 96X0,2ML REDProfile, red, 25 plates

Thermo Scientific™ Nuclease-free Water

X4 Molecular biology reagents, water, nuclease-fre

Applied Biosystems™ MicroAmp™ Optical 384-Well Reaction Plate with Barcode

Designed to provide unmatched temperature accuracy and uniformity for fast, efficient PCR amplification X50 MICROAMP OPTICAL 384-WELL REACTION PLATE WITHbarcode Store at room temperature
