missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ T7 Promoter Primer

Product Code. 11675591
Click to view available options
Quantity:
2 μg
Unit Size:
2µg
This item is not returnable. View return policy
For Research Use Only. All usage must comply with product instructions.
 

Product Code. 11675591

Brand: Invitrogen™ N56002

Please to purchase this item. Need a web account? Register with us today!

This item is not returnable. View return policy
For Research Use Only. All usage must comply with product instructions.
 

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.

T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity

Applications
• Sanger sequencing
• PCR amplification

T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´

Order Info

Shipping Conditions: Room Temperature

TRUSTED_SUSTAINABILITY

Specifications

Promoter T7
Product Type Primer
Content And Storage • T7 Promoter Primer (2 μg)

Store in Freezer at –20°C.
Guaranteed stable for 6 months when properly stored.
Primer Length 20-mer
Primer Sequence 5 ́d[TAATACGACTCACTATAGGG]3 ́
Purification Method Gel-purified
Shipping Condition Room Temperature
Primer T7
Quantity 2 μg
For Use With (Application) PCR Amplification
Form Lyophilized
Show More Show Less

For Research Use Only. Not for use in diagnostic procedures.

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.