missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ GeneRacer™ Kit with SuperScript™ III RT and TOPO TA Cloning™ Kit for Sequencing

Product Code. 10093232
Change view
Click to view available options
Quantity:
1 Kit
Unit Size:
5mL
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Product Code. Quantity unitSize
10093232 1 Kit 5mL
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
This item is not returnable. View return policy
For Research Use Only. All usage must comply with product instructions.
 
Product Code. 10093232 Supplier Invitrogen™ Supplier No. L150201

Please to purchase this item. Need a web account? Register with us today!

This item is not returnable. View return policy
For Research Use Only. All usage must comply with product instructions.
 

Ensures amplification of only full-length transcripts via elimination of truncated messages from amplification process

The GeneRacer Kit provides a method to obtain full-length 5' and 3' ends of cDNA using known cDNA sequence from expressed sequence tags (ESTs), subtracted cDNA, differential display, or library screening. RACE PCR products can be quickly and easily cloned using either the Zero Blunt TOPO PCR Cloning Kit for Sequencing (blunt-end PCR products) or the TOPO TA Cloning for Sequencing Kit (PCR products with 3' A-overhangs). Using the protocols provided, the cDNA ends of rare (30 copies/cell) and long (9 kb) transcripts can be amplified and sequenced starting from 1μg of total RNA.

  • Generate cDNA from transcripts at least 10kb in length
  • Obtain full-length 5' end of rare transcripts at fewer than 30 copies per cell
  • Clone full-length 5' and 3' ends to construct complete cDNA sequence

Cloning, PCR and Real-Time PCR, Reverse Transcription, cDNA Libraries and Library Construction

Order Info

Shipping Condition: Dry ice

TRUSTED_SUSTAINABILITY

Specifications

Bacterial or Yeast Strain TOP10
Cloning Method TOPO TA
Content And Storage Store each module as indicated:

GeneRacer™ Module (-20°C):

• 2 × 1.5 ml Sterile Water

• 24 μl RNaseOut™

• 6 μl each Calf Intestinal Phosphatase (CIP), CIP Buffer, Tobacco Acid Pyrophosphatase (TAP), 10X TAP Buffer, T4 RNA Ligase, 10X T4 RNA Ligase Buffer, and 10 mM ATP

• 6 × 250 ng GeneRacer™ RNA Oligo

• 2 × 1 ml Phenol/Chloroform

• 36 μl Mussel Glycogen

• 200 μl Sodium Acetate (3 M)

• 225 μl each GeneRacer™ 5′ Primer, 5′ Nested Primer, 3′ Primer, and 3′ Nested Primer

• 20 μl Control HeLa Total RNA (500 ng/μl)

• 15 μl each Control Primer A and Control Primer B.1

SuperScript™ III RT Module (-20°C)

• 6 μl SuperScript™ III Reverse Transcriptase (200 U/μl)

• 24 μl 5X First Strand Buffer

• 15 μl DTT (0.1 M)

• 6 μl RNaseH (2 U/μl)

• 6 μl Random Primers (100 ng/μl)

• 6 μl GeneRacer™ Oligo dT Primer (900 ng/μl)

• 6 μl dNTP Mix (10 mM each)

10 S.N.A.P.™ Columns (room temperature)

TOPO TA Cloning™ Kit for Sequencing (-20°C)

• Sufficient reagents and One Shot™ TOP10 Chemically Competent E. coli (store at -80°C) to clone 10 GeneRacer™ PCR products; GeneRacer Module (-20°C), SuperScript III RT Module (-20°C), Competent E. coli (store at -80°C), S.N.A.P. Columns (room temperature), TOPO TA Cloning Kit for Sequencing (-20°C)
Format Kit
For Use With (Application) Reverse Transcription
Includes GeneRacer Module: 2 x 1.5mL Sterile Water, 24μL RNaseOut, 6μL each Calf Intestinal Phosphatase (CIP), CIP Buffer, Tobacco Acid Pyrophosphatase (TAP), 10X TAP Buffer, T4 RNA Ligase, 10X T4 RNA Ligase Buffer, and 10mM ATP, 6 x 250ng GeneRacer RNA Oligo, 2 x 1mL Phenol/Chloroform, 36μL Mussel Glycogen, 200μL Sodium Acetate (3M), 225μL each GeneRacer 5' Primer, 5' Nested Primer, 3' Primer, and 3' Nested Primer, 20μL Control HeLa Total RNA (500ng/μL), 15μL each Control Primer A and Control Primer B.1; SuperScript III RT Module: 6μL SuperScript III Reverse Transcriptase (200U/μL), 24μL 5X First Strand Buffer, 15μL DTT (0.1M), 6μL RNaseH (2U/μL), 6μL Random Primers (100ng/μL), 6μL GeneRacer Oligo dT Primer (900ng/μL), 6μL dNTP Mix (10mM each), 10 S.N.A.P. Columns, TOPO TA Cloning Kit for Sequencing (-20°C), Sufficient reagents and One Shot TOP10 Chemically Competent E. coli
Product Line GeneRacer, SuperScript, TA Cloning, TOPO
Product Type Cloning Kit
Quantity 1 Kit
Vector pCR4-TOPO TA
I'm getting PCR products from my 5' RACE, but they are not full length. What should I do?

The GeneRacer method is designed to ensure that only full-length messages are ligated to the GeneRacer RNA Oligo and PCR amplified after cDNA synthesis. It is highly recommended that you clone your RACE products and analyze at least 10-12 colonies to ensure that you isolate the longest message. Many genes do not have only one set of transcription start sites but rather multiple transcription start sites spanning sometimes just a few or other times a hundred or even more bases. Cloning of the RACE products and analyzing multiple colonies ensues that you detect the diversity of the heterogeneous transcription start sites of your gene. It is also possible that you might obtain PCR products that may not represent the full-length message for your gene. PCR products that do not represent full-length message may be obtained because:

-RNA degradation after the CIP reaction creates new truncated substrates with a 5' phosphate for ligation to the GeneRacer RNA Oligo. Be sure to take precautions to ensure that the RNA is not degraded.
-CIP dephosphorylation was incomplete. Increase the amount of CIP in the reaction or decrease the amount of RNA.
-PCR yielded a PCR artifact and not true ligation product. Optimize your PCR using the suggestions described above.

I'm seeing RACE PCR artifacts in my GeneRacer experiment. What am I doing wrong?

RACE PCR artifacts or nonspecific PCR bands can result from one or more of the following:

-Nonspecific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired products.
-Nonspecific binding of GeneRacer primers to cDNA resulting in PCR products with GeneRacer primer sequence on both ends of the PCR product.
-RNA degradation.
-Contamination of PCR tubes or reagents.
Note: Artifacts usually result from less than optimal PCR conditions and can be identified in negative control PCR.

I'm getting unexpected bands after electrophoretic analysis of my amplified RT-PCR products. Can you please offer some suggestions?

Please see the following causes and suggestions:
Contamination by genomic DNA or an unexpected splice variant - Pretreat RNA with DNase I, amplification grade (Cat. No 18068015).
Design primers that anneal to sequences in exons on both sides of an intron or at the exon/exon boundary of the mRNA to differentiate between amplified cDNA and potential contaminating genomic DNA.
To test if products were derived from DNA, perform a minus RT control.
Nonspecific annealing of primers - Vary the PCR annealing conditions.
Use a hot-start PCR polymerase.
Optimize magnesium concentration for each template and primer combination.
Primers formed dimers - Design primers without complementary sequences at the 3' ends.

I'm getting no bands after electrophoretic analysis of my amplified RT-PCR products. Can you please offer some tips?

Please see the following causes and suggestions:

Procedural error in first-strand cDNA synthesis - Use high-quality RNA as a control to verify the efficiency of the first-strand reaction.
RNase contamination - Add control RNA to sample to determine if RNase is present in the first-strand reaction. Use an RNase inhibitor in the first-strand reaction.
Polysaccharide co-precipitation of RNA - Precipitate RNA with lithium chloride to remove polysaccharides, as described in Sambrook et al.
Target mRNA contains strong transcriptional pauses - Use random hexamers instead of oligo(dT) in the first-strand reaction, increase the temperature, and use PCR primers closer to the 3' terminus of the target cDNA.
Too little first-strand product was used in PCR - Use up to 10% of first-strand reaction per 50 mL PCR.
Gene-specific primer was used for first-strand synthesis - Try another set of GSP or switch to oligo(dT). Make sure the GSP is the antisense of the sequence.
Inhibitors of RT present - Remove inhibitors by ethanol precipitation of mRNA preparation before the first-strand reaction. Include a 70% (v/v) ethanol wash of the mRNA pellet. Note: inhibitors of RT include SDS, EDTA, guanidinium salts, formamide, sodium pyrophosphate, and spermidine.
RNA has been damaged or degraded - Ensure that high-quality, intact RNA is being used.
Annealing temperature is too high - Decrease temperature as necessary and/or use touchdown PCR.

How does the 3' RACE system work?

3' RACE takes advantage of the natural poly(A) tail found in mRNA as a generic priming site for PCR. In this procedure, mRNAs are converted into cDNA using reverse transcriptase (RT) and an oligo-dT adapter primer. Specific cDNA is then amplified by PCR using a gene-specific primer (GSP) that anneals to a region of known exon sequences and an adapter primer that targets the poly(A) tail region. This permits the capture of unknown 3'-mRNA sequences that lie between the exon and the poly(A) tail.

What are some ways for me to optimize my RACE reaction?

Here are our suggestions to optimize your RACE reaction:

-Use high-quality, intact RNA
-Use an RNA sample in which your gene is expressed at high levels
-Do not exceed the recommended amount of input material in each step
-Optimize annealing temperatures for PCR
-Include recommended controls

Why does my RACE reaction show more than one band?

Alternative splicing, an alternative polyadenylation site, and alternative start sites can yield legitimate multiple bands. Sequencing will help to resolve any uncertainty.

How do I know if my bands from RACE are real?

If the reaction gives a specific product and the control reaction does not, your band is probably real. The only way to be sure is to sequence the product.

How do I design my gene-specific primers for my GeneRacer experiment?

If you are performing either 5' or 3' RACE, you will need one gene-specific primer and if you are performing both 5' and 3' RACE, you would need two gene-specific primers. The primers should follow the rules stated below:

-50-70% GC content to obtain a high annealing temp (>72 degrees C)
-23-28 nucleotides in length to increase specificity of binding
-Low-GC content at 3' ends to minimize extension by DNA polymerase at non-target sites (no more than two G or C residues in the last five bases)
-No self-complementary sequences within the primer or no sequence complementary to the primers supplied in the kit, especially at the 3' end
-Annealing temperature greater than 72 degrees C—using primers with a high annealing temperature will help to improve specificity of your PCR

How can I check the integrity of my starting RNA sample for RACE?

To check the RNA for integrity, analyze 500 ng of your RNA by agarose/ethidium bromide gel electrophoresis. You may use a regular 1% agarose gel or a denaturing agarose gel. For total RNA you should see the 28S and 18S rRNA bands. mRNA will appear as a smear from 0.5 to 12 kb. The 28S band should be twice the intensity of the 18S band. If you do not load enough RNA, the 28S band may appear to be diffuse. If you are using a denaturing gel, the rRNA bands should appear very clear and sharp. The 28S band should run at 4.5 kb and the 18S band should run at 1.9 kb.

What is RACE and what does it stand for?

RACE stands for Rapid Amplification of cDNA Ends. It is a method used to discover the 5' and/or 3' end of full-length transcripts. If partial sequence is known for a transcript of interest, RACE can help to elucidate the full ORF, 5' UTR, and 3' UTR sequences.

How can I prevent smearing when using GeneRacer Kit?

Several factors are important for the best results.

(1) The key factor for success is the quality of the RNA. RNA degradation is the most likely reason for failure to obtain a correct RACE product. We strongly recommend that you analyze a sample of your RNA on an agarose gel before starting to confirm RNA integrity. The use of RNaseOUT RNase inhibitor ensures RNA stability during various enzymatic reactions. If you are concerned about RNA stability, you may check the stability of the RNA after each enzymatic reaction (CIP, TAP, and ligation reaction) using agarose gel electrophoresis. Resuspend the RNA in DEPC water after enzymatic treatment in an appropriate volume (see pages 7, 9 and 11 of GeneRacer kit manual) and check 1 µL on an agarose gel. Compare with the same amount of untreated RNA to check for degradation.

(2) RACE PCR artifacts or non-specific PCR bands can result from one or more of the following:
-Non-specific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired products.
-Non-specific binding of GeneRacer primers to cDNA resulting in PCR products with GeneRacer primer sequence on one end.
-RNA degradation.
-Contamination of PCR tubes or reagents.

Note: Artifacts usually result from less-than-optimal PCR conditions and can be identified in negative control PCR.

(3) If a smear in GeneRacer 5' primer negative control is visible, then we recommend the following:
-Use a different 5' primer, called the GeneRacer 5' primer. It is homologous to the slightly different site at the RNA oligo but it generally gives less background compared to the original 5' primer. Here is the sequence of the GeneRacer 5' primer: 5' GCACGAGGACACTGACATGGACTGA This primer can be synthesized and used in the 5' RACE PCR instead of the original 5' primer. It should reduce the background in RACE PCR.

(4) If you see smears when performing the negative control using 5' primer, the other negative controls (no template, GSP with template) were fine, and all reactions had the same PCR conditions, then:
-If there is background when using the 5' primer and template than you should subtract those bands/smear from the actual RACE reaction discarding it so that not to confuse with the real RACE bands. The smear in that negative control will always be there because every cDNA has the binding site for that primer. So there should not be any major concern about the smear. If the actual RACE PCR works then the RACE band would outweigh the smear background.

What PCR enzyme would you recommend for use with the Directional TOPO Cloning Kits?

For the Directional TOPO Cloning Vectors, a PCR product must be generated by a proofreading enzyme to create a blunt product. Pfx50 or Accuprime Pfx and Accuprime Pfx Supermix from Thermo Fisher Scientific are recommended for use.

When cloning a Pfx-amplified PCR product, the insert to vector ratio is an important consideration. The PCR product generally needs to be diluted since Pfx generates a high concentration of product and using too much insert DNA can hamper the TOPO reaction. A 1:1 molar ratio of vector to insert (or about 2-10ng of insert) is recommended.

Can I use a DNA polymerase mixture containing both Taq polymerase and a proofreading polymerase for TA Cloning?

If you wish to use a polymerase mixture containing Taq polymerase and a proofreading polymerase, Taq must be used in excess with a 10:1 ratio of Taq to the proofreading enzyme to ensure the presence of 3´ A-overhangs on the PCR product. If you use polymerase mixtures that do not have enough Taq polymerase or a proofreading polymerase only, you can add 3' A-overhangs following PCR. See the vector product manuals for details.

Some examples of Taq blends that are compatible with TOPO TA Cloning are Platinum Taq DNA Polymerase High Fidelity and AccuPrime Taq DNA Polymerase High Fidelity.

How does TA Cloning work?

Taq polymerase has a non-template-dependent terminal transferase activity that adds a single deoxyadenosine (A) to the 3´ ends of PCR products. The linearized vector supplied in our TA Cloning kits have single, overhanging 3´ deoxythymidine (T) residues. This allows PCR inserts to ligate efficiently with the vector.

What are the melting temperatures for the M13 Forward (-20) and M13 Reverse primers in the TOPO Cloning and Zero Blunt Kits?

Assuming that the primer is at a 50 nM final concentration and 50 mM final salt concentration, the melting temperatures are: M13 Forward (-20) Primer = 52.7 and the M13 Reverse Primer = 45.3. For use in the control PCR reaction we recommend using an annealing temperature of 56C.

What is the role of Calf Intestinal Phosphatase (CIP) enzyme in your GeneRacer kit?

CIP will remove the 5' phosphates from DNA or RNA, acting on both protruding or recessed phosphates. In the GeneRacer kit, it is used to eliminate any background RNA, including non-mRNA or truncated mRNA that does not have the 5' Methyl Cap structure. CIP will not digest the Methyl Cap structure, allowing these capped transcripts to be further processed in the GeneRacer protocol and only allowing full length transcripts to be amplified by 5' RACE.


For Research Use Only. Not for use in diagnostic procedures.

Product Title
Select an issue

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.