missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. Molecular Biology Reagents and Kits
  4. DNA Vectors
  5. Cytiva GST Vector Primers for Sequencing

Cytiva GST Vector Primers for Sequencing

Product Code. 10784157 Shop All Cytiva Products
Click to view available options
Primer:
pGEX 3′ Sequencing
pGEX 5′ Sequencing
Unit Size:
Each
This item is not returnable. View return policy

Product Code. 10784157

Brand: Cytiva 27141101

Please to purchase this item. Need a web account? Register with us today!

This item is currently unavailable or has been discontinued.
View the product page for possible alternatives.
 View alternative products

This item is not returnable. View return policy

Description

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

  • Provided ready for immediate use
  • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

TRUSTED_SUSTAINABILITY

Specifications

For Use With (Equipment) Glutathione S-transferase (GST) gene fusion system
Content And Storage -20°C
Primer pGEX 3′ Sequencing
Quantity 260 U
For Use With (Application) Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors
Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.