Learn More
Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO501
46.33 GBP valid until 2024-03-29
Use promo code "21615" to get your promotional price.
Code : 88
Additional Details : Weight : 0.00500kg
Description
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)
Specifications
Forward Sequencing Primer | |
Dry Ice | |
pJET | |
Sequencing |
T3 promoter Sequencing Primer, 24-mer, 10 μM Store at –20°C. |
|
10 μM | |
pJET1.2 | |
Liquid |
For Research Use Only. Not for use in diagnostic procedures.