Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR.

Overview
Brand: Thermo Scientific™

Manufacturer Part Number: SO501

PJET1.2 FORWARD SEQUENCING PRIMER, 23-MER, 5'-D(CGACTCACTATAGGGAGAGCGGC)-3, 10µm, 8.7nmol Store at

UNSPSC: 41105327

Code: 88

Additional Details:
Additional Details: Weight: 0.00500kg



Product Code. 10590091

Quantity Price
1 £ 49.66 / Each
EU Stock 2
Add to basket


Description and Specification

Specification

For Use With (Application) Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2; Colony screening by PCR
Product Type pJET™1.2 forward sequencing primer, 23-mer
Quantity 0.2 A260, (6.7µg)

Applications

  • Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2
  • Colony screening by PCR