GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Overview
Brand: GE Healthcare Lifescience

Manufacturer Part Number: 27141101

PGEX 3' SEQUENCING PRIMER 5'-D¢CCG-GGAGCTGCATGTGTCAGAGG!-3' 00 Store in freezer at -20C

UNSPSC: 41116133

Code: GE

Additional Details:
Additional Details: Weight: 0.62140kg



Product Code. 10784157

Quantity Price
1 £ 113.56 / Each
Estimated Shipment
21-12-2016
Add to basket

If this item is out of stock, delivery will be in 3-4 working days providing the item is in stock at the supplier.
Please enquire with customer services on 01509 555500 for stock availability.

 

Description and Specification

Specification

For Use With (Equipment) Glutathione S-transferase (GST) gene fusion system
For Use With (Application) Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors
Primer pGEX 3′ sequencing primer
Quantity 260U
Storage Requirements -20°C

  • Provided ready for immediate use
  • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’