missing translation for 'onlineSavingsMsg'
Learn More

GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Brand:  GE Healthcare Lifescience 27-1411-01

Code : GE

Additional Details : Weight : 0.62140kg

 View more versions of this product

Product Code. 10784157

  • £122.01 / Each

Call for latest availability
+44 (0)1509 555 500
Add to basket

If this item is out of stock, delivery will be in 3-4 working days providing the item is in stock at the supplier.
Please enquire with customer services on 01509 555500 for stock availability.

  • Provided ready for immediate use
  • pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
  • pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

Glutathione S-transferase (GST) gene fusion system
pGEX 3′ sequencing primer
Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors