Cytiva GST Vector Primers for Sequencing

Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence

Brand:  Cytiva 27-1411-01

Product Code. 10784157

Description

• Provided ready for immediate use
• pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
• pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’

Specifications

• For Use With (Equipment): Glutathione S-transferase (GST) gene fusion system
• Primer: pGEX 3′ Sequencing
• For Use With (Application): Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors

• Content And Storage: -20°C
• Quantity: 260 U