missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Cytiva GST Vector Primers for Sequencing
Forward and reverse sequencing primers flanking the multiple cloning site of all pGEX vectors in the GST fusion system, for verification of inserted DNA sequence
£127.00 - £130.00
Specifications
| For Use With (Equipment) | Glutathione S-transferase (GST) gene fusion system |
|---|---|
| Content And Storage | -20°C |
| Quantity | 260 U |
| For Use With (Application) | Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors |
| Product Code | Brand | Primer | Price | Quantity & Availability | |||||
|---|---|---|---|---|---|---|---|---|---|
| Product Code | Brand | Primer | Price | Quantity & Availability | |||||
|
10774157
|
Cytiva
27-1410-01 |
pGEX 5′ Sequencing |
This item is currently unavailable or has been discontinued. View the product page for possible alternatives. |
||||||
|
10784157
|
Cytiva
27-1411-01 |
pGEX 3′ Sequencing |
This item is currently unavailable or has been discontinued. View the product page for possible alternatives. |
||||||
Description
- Provided ready for immediate use
- pGEX 5’ Sequencing Primer: 5’-d[GGGCTGGCAAGCCACGTTTGGTG]-3’
- pGEX 3' Sequencing Primer: 5’-d[CCGGGAGCTGCATGTGTCAGAGG]-3’
Specifications
| Glutathione S-transferase (GST) gene fusion system | |
| -20°C | |
| 260 U | |
| Ready-to-use in sequencing double-stranded DNA inserted into pGEX Vectors |